Нажмите "Enter" для пропуска содержимого

St88: Samsung ST88 Black купить в KNS. Фотоаппарат Samsung ST88 Black

Содержание

Изоляционная погодоустойчивая лента ПВХ высшего класса PANDUIT ST88-150-66BK

В интернет-магазине РИТМ-ИТ Вы можете купить «Изоляционная погодоустойчивая лента ПВХ высшего класса PANDUIT ST88-150-66BK » по небольшой цене. В данной карточке можно ознакомиться с техническими характеристиками этого товара. Цена включает НДС. Для получения дополнительных сведений обращайтесь к нашим менеджерам по номеру телефона 8-495-792-80-01. Если вы уже выбрали подходящий товар, отправьте заявку через корзину или по электронной почте, и наши менеджеры оперативно свяжутся для его подтверждения. Если Вы ещё не определились с моделью, то сможете получить консультацию от специалиста. «Изоляционная погодоустойчивая лента ПВХ высшего класса PANDUIT ST88-150-66BK » отличается высоким надёжностью. Все товары в интернет-магазине можно оплатить любым удобным способом. Мы предоставляем отличные скидки на оптовые заказы. На все товары распространяется официальная гарантия от вендора. Если вы не нашли на портале требуемый товар, то его наличие можно уточнить. Мы находимся в Москве и доставляем товарные позиции по всей территории Российской Федерации. В Москве возможно получить товар самостоятельно или заказать быструю доставку курьером. По РФ мы доставляем заказы транспортными компаниями. Мы предоставляем полный набор сопроводительных документов для покупателя.

Работаем с любыми способами оплаты: принимаем наличные, предоплату и предоставляем кредит. Наш товар доставляется в любую точку России. Мы работаем с крупнейшими перевозчиками, которые доставят Ваш заказ быстро и надежно. Доставка по Москве зависит от стоимости и весогабаритов заказа. Возможна бесплатная доставка, условия обсуждаются с менеджером. Все цены указаны в рублях и включают НДС 20% (кроме лицензий на ПО). Работаем как с бумажными документами, так и с электронными через ЭДО.

Вы можете самостоятельно произвести оплату на сайте. После оформления заказа и одобрения его менеджером Вам будут предложены следующие варианты оплаты:

1. Банковской картой (Visa, MasterCard, Maestro, МИР).
2. Банковским переводом для юридических и физических лиц по выставленному счету.
3. Электронными деньгами через платёжный сервис Яндекс Касса.
4. По частям через платёжный сервис Яндекс Касса.

Изоляционная погодоустойчивая лента ПВХ высшего класса PANDUIT ST88-075-66BK

На нашем сайте Вы можете купить «Изоляционная погодоустойчивая лента ПВХ высшего класса PANDUIT ST88-075-66BK » по небольшой цене. На этой странице можно ознакомиться с параметрами этого товара. Цена включает НДС. Для получения дополнительных сведений обращайтесь к нашим менеджерам по номеру телефона 8 800 100-76-17. Если вы уже выбрали подходящий товар, оформите заказ через корзину или по электронной почте, и сотрудники в кратчайшие сроки свяжутся для его подтверждения. Если Вы ещё не определились с моделью, то сможете получить ответ от специалиста. «Изоляционная погодоустойчивая лента ПВХ высшего класса PANDUIT ST88-075-66BK » отличается высоким качеством. Все товары в интернет-магазине можно оплатить различными способами. Мы предоставляем отличные скидки на оптовые заказы. На все товары распространяется официальная гарантия от производителя. Если вы не нашли на портале нужный продукт, то его наличие можно уточнить. Мы находимся в Москве и доставляем товарные позиции по всей территории России. В Москве возможно получить товар из точки самовывоза или заказать оперативную доставку курьером. По России мы доставляем транспортными компаниями. Мы предоставляем полный комплект сопроводительных документов для покупателя.

Работаем с любыми способами оплаты: принимаем наличные, предоплату и предоставляем кредит. Наш товар доставляется в любую точку России. Мы работаем с крупнейшими перевозчиками, которые доставят Ваш заказ быстро и надежно. Доставка по Москве зависит от стоимости и весогабаритов заказа. Возможна бесплатная доставка, условия обсуждаются с менеджером. Все цены указаны в рублях и включают НДС 20% (кроме лицензий на ПО). Работаем как с бумажными документами, так и с электронными через ЭДО.

Вы можете самостоятельно произвести оплату на сайте. После оформления заказа и одобрения его менеджером Вам будут предложены следующие варианты оплаты:

1. Банковской картой (Visa, MasterCard, Maestro, МИР).
2. Банковским переводом для юридических и физических лиц по выставленному счету.
3. Электронными деньгами через платёжный сервис Яндекс Касса.
4. По частям через платёжный сервис Яндекс Касса.

Station 88 [ST88] — Organizations

ЦЕЛИ СИНДИКАТА:

выполнение контрактов различного рода за вознаграждение,

научная деятельность команды и оказание медицинских услуг,
развитие торговых отношений со сторонними организациями,
получение прибыли с перевозимой синдикатом контрабанды,
ремонт и переработка поврежденной и захваченной техники,
добыча ресурсов на подкотрольных синдикату территориях,
инженерные работы по освоению новых территорий синдикатом,
экспедиции и экспансии эскадры во вселенной Звездного гражданина.

ЭСКАДРА СИНДИКАТА:

Эскадра позволит отстаивать синдикату свои интересы в предстоящих битвах за новые территории и ресурсы, организовывать исследовательские экспедиции и осуществлять в дальнейшем экспансии во вселенной Звездного гражданина. В дальнейшем эскадра должна быть представлена боевым и экспедиционным корпусами:

боевой корпус эскадры начнет формироваться из истребителей и боевых космических кораблей синдиката, а также бойцов штурмовиков, целью которых станет как высадка и наземный бой с применением боевой техники, так и абордаж космических кораблей,
состав экспедиционного корпуса будет представлен кораблями различного предназначения, целью которого будет исследование вселенной Звездного гражданина, а также проведение строительных, инженерных и других работ на территориях синдиката.

РАНГИ СИНДИКАТА:

Основатель космической станции и глава синдиката – Captain Jarlen
Старший помощник капитана – Anders Star. На Старпома возложено управление синдикатом в отсутствии его главы, рассмотрение и прием в синдикат новых игроков, а также присвоение нижестоящих рангов. Старпом в том числе курирует социальное и дипломатическое направление в синдикате.
Главный оружейник. В задачи Оружейника входят вопросы всестороннего боевого обеспечения синдиката и подготовка команды эскадры. Главный оружейник возглавляет боевой корпус эскадры.
Архитектор станции. На Архитекторе станции лежит задача по управлению экспедиционным корпусом. В синдикате курирует техническое направление, сферу торговли и добычи ресурсов, а также строительные и инженерные работы на территориях синдиката.
Майор. Ранг майора отличает старшинство игрока на различных направлениях работы, и подчеркивает его опыт и приверженность синдикату. В эскадре ранг майора может относить игрока к командирскому составу, или подчеркивать его высокие достижения,
Лейтенант – основной ранг игроков состоящих в синдикате,
Рекрут. Ранг рекрут присваивается вновь прибывшему игроку в синдикат,
Ветеран. Активный игрок, пробывший в синдикате более 5 лет, может получить статус ветерана, что дает право быть почетным гостем, а также получать определенные синдикатом в дальнейшем вознаграждения.

Характеристики Samsung ST88 (Самсунг СТ88)

Samsung ST88

Характеристики

Samsung ST88: Характеристики

Характеристики

`

16.40 МП, 1/2.3″, Zoom: 5х, видео до 1280×720, 114 г

Характеристики

Камера

Тип камеры

цифровая

Объектив

Фокусное расстояние (35 мм эквивалент)

25 — 125 мм

Оптический Zoom

5x

Мультимедийные возможности

Диафрагма

F2.5 — F6.3

Матрица

Общее число пикселов

16.4 млн

Число эффективных пикселов

16.1 млн

Кроп-фактор

5.62

Максимальное разрешение

4608 x 3456

Чувствительность

80 — 3200 ISO, Auto ISO

Размер

93x55x17 мм

Экран

Тип матрицы

СCD

Функциональные возможности

Баланс белого

автоматический, из списка

Вспышка

встроенная, до 4.20 м, подавление эффекта красных глаз

Стабилизатор изображения (фотосъемка)

оптический, подвижный элемент в объективе

Режимы съемки

Макросъёмка

есть

Режим серийной съемки

есть

Время работы таймера

2, 10 c

Формат кадра (фотосъемка)

4:3, 3:2, 16:9

Видоискатель и ЖК-экран

Видоискатель

отсутствует

Использование экрана в качестве видоискателя

есть

ЖК-экран

460000 точек, 3 дюйма

Экспозиция

Выдержка

8 — 1/2000 с

Ручная настройка выдержки и диафрагмы

есть

Автоматическая обработка экспозиции

с приоритетом затвора

Экспокоррекция

+/- 2 EV с шагом 1/3 ступени

Замер экспозиции

3D цветовой матричный, центровзвешенный, точечный

Фокусировка

Подсветка автофокуса

есть

Фокусировка по лицу

есть

Минимальное расстояние съемки

0.05 м

Память и интерфейсы

Тип карт памяти

micro SD, micro SDHC

Максимальный объем карты памяти

8 Гб

Объём встроенной памяти

70 Мб

Форматы изображения

JPEG

Интерфейсы

USB 2.0, видео, аудио

Питание

Формат аккумуляторов

свой собственный

Количество аккумуляторов

1

Емкость аккумулятора

700 мА*ч

Функции

Запись видео

есть

Запись видео и звука

Формат записи видео

AVI

Видеокодеки

MJPEG

Максимальное разрешение роликов

1280×720

Максимальная частота кадров видеоролика

30 кадров/с

Максимальная частота кадров при съемке HD-видео

25/30 кадров/с при разрешении 1280×720

Время записи видео

20 минут

Оптический Zoom при записи видео

есть

Запись звука

есть

Другие функции и особенности

Комплектация

аккумуляторная батарея, адаптер питания переменного тока, USB-кабель, ремень фотокамеры, руководство пользователя

Холод

Дополнительные возможности

крепление для штатива

Технические параметры

Вес

114 г, без элементов питания

Популярные товары

Canon EOS 5D Mark IV

Обещанного четыре года ждут. Что нового в популярной камере?

5 (из 5 возможных)

Пандуит | СТ88-075-66БК

Суббренд СтронгХолд™
Тип продукта Сверхмощный
Цвет Чернить
Материал Поливинилхлорид (ПВХ)
Общая толщина (в.) 0,0085
Общая толщина (мм) 0,21
Общая ширина (в.) 0,75
Общая ширина (мм) 19
Общая длина (фут.) 66
Общая длина (м) 20
Прочность на разрыв (Н/см) 38
Растяжение при разрыве (кг/мм) 0.39
Относительное удлинение при разрыве (%) 300
Адгезия к стали (Н/см) 2.2
Адгезия к стали (унции/дюймы) 20.1
Адгезия к подложке (Н/см) 2.2
Адгезия к подложке (унция/дюйм) 20.1
Рейтинг воспламеняемости UL 510 Огнестойкий
Маркировка (мм) 0
Максимальная рабочая температура (°C) 105
Максимальная рабочая температура (°F) 221
Минимальная рабочая температура (°C) -18
Минимальная рабочая температура (°F) 0
Стандарт диэлектрической прочности (кВ) 10
Диэлектрическая прочность во влажном состоянии (90%) (кВ) 8.1
Сопротивление изоляции (МОм) 1.Е+06
Соответствие стандартам Соответствует ASTM D-3005, тип 1; EN 60454-3-1, тип 11; UL 510 CSA C 22.2 № 197; Соответствует директивам 2000/53/EC и RoHS 2011/65/EU
Сертификаты соответствия Зарегистрировано UL/сертифицировано CSA
Окружающая среда Внутри снаружи
Заявление Подрядчик, электротехническое строительство, промышленное строительство, производство, техническое обслуживание и ремонт
Срок службы (год) 5
Стиль ленты Сверхмощный
Клейкий материал основы Резинка

Преобладание вирулентных и образующих биопленку клонов ST88-IV-t2526, устойчивых к метициллину Staphylococcus aureus, циркулирующих на местных розничных рыбных рынках в Ассаме, Индия

https://doi.org/10.1016/j.foodcont.2021.108098Получить права и содержание

Highlights

Первый отчет из Индии о заболеваемости клоном ST88-IV MRSA в товарной рыбе.

Документально подтверждено преобладание MRSA, относящегося к t2526; очень редкий тип spa .

Токсигенный потенциал MRSA был описан высокой распространенностью локусов pvl , seb , seg и sei .

ica локус AD, clfB , fib и fnbB были генами, идентифицированными в MRSA как связанные с образованием биопленки.

агр Сообщается, что преобладающими аллельными типами являются I и III.

Abstract

Бремя устойчивости к противомикробным препаратам (УПП), особенно в Индии, тревожно увеличилось. Устойчивость к метициллину у Staphylococcus aureus была признана серьезной угрозой для человека, особенно если они образуют биопленки и снабжены факторами вирулентности.В настоящем исследовании мониторинг устойчивого к антибиотикам S. aureus проводился на трех выбранных участках в Ассаме, Индия, в августе 2019 г. и феврале 2020 г. Этнографическая информация была собрана у продавцов рыбы, чтобы отслеживать и устранять потенциальные источники заражения. Двадцать три потенциально устойчивых к метициллину изолята S. aureus (MRSA) были идентифицированы из рыбы, продаваемой поставщиками, и подвергнуты молекулярной характеристике. Профиль устойчивости этих изолятов MRSA к противомикробным препаратам расценивался как множественная лекарственная устойчивость (MDR), поскольку они были устойчивы к ≥3 классам антибиотиков.Наиболее распространенный профиль сопротивления был; ампициллин-цефазолин-цефокситин-гентамицин-норфлоксацин-оксациллин-пенициллин. Установлено, что регуляторы дополнительных генов III ( agr III) типа MRSA (18/23, 78,26%) преобладают по сравнению с agr I типа (5/23, 21,74%). Было обнаружено, что четыре изолята (17,39%) несут элементы SCC mec -IV, что является типичным признаком внебольничного MRSA (CA-MRSA). Было обнаружено, что два изолята MRSA SCC mec -IV содержат гены токсина пантон-валентин-лейкоцидин (PVL) и устойчивы к макролидам в дополнение к бета-лактамам.MLST и типирование spa идентифицировали все MRSA как ST88 с spa типа t2526. Это первый отчет из Индии о заболеваемости MRSA ST88-SCC mec -IV (ST88-IV) на рыбном рынке и в его водной среде. Высокая распространенность одного клона MLST, ST88, предполагает, что эта линия имеет уникальное преимущество в выживании в этой среде. В исследовании обсуждается вклад больничных сточных вод в распространение патогенных клонов MRSA в водные ресурсы, а затем к людям через пищевую цепь.

Ключевые слова

CA-MRSA

CA-MRSA

Молекулярная эпидемия

Гены вирулентности

Гены вирулентности

Гены BiOfilm, связанные с биопленками

Рыбы Образцы

Рекомендуемые статьи

Посмотреть полный текст

Crown Copyright © 2021 Опубликовано Elsevier Ltd. Все права защищены.

ST88 Эластичный рулон из морского стекла

Гибкий стиль для спортивной одежды и не только!

Функциональная одежда соответствует своим требованиям! EasyWeed Stretch от Siser обладает всеми преимуществами нашего теплопередающего материала EasyWeed и сочетает его со сверхрастяжимостью для создания одного замечательного теплопередающего материала! Самый тонкий из всех материалов Siser, EasyWeed Stretch имеет ультраматовую поверхность и мягкую поверхность, доступную в 20 популярных цветах, включая сладкую мяту и коралл.В то время как EasyWeed Stretch идеален для спортивной одежды, его мягкость и малый вес часто делают его фаворитом для украшения других предметов одежды.

EasyWeed Stretch сертифицирован CPSIA, поэтому он безопасен для одежды всех возрастов!

Характеристики: Полиуретановый состав • Чувствительная к давлению основа • Ультраматовая поверхность • 85 микрон/3,5 мил • Лезвие 45°/60° • Можно наслаивать На
Silhouette Cameo: Лезвие: Стандартное, 3
Настройка: Материал теплопередачи (гладкий)
Скорость: 8
Толщина: 6
Scan N Cut: Лезвие: 2
Cut Speed03: 4 Давление: 1
Roland GS/GX-24: Лезвие: 45°
Грамм Усилие: 60-70
Вылет: .250
Скорость: 30 см / с
Graphtec: Blade: 45 °
Грамба: 9-10
Инструмент: 9-10
Инструмент: CB09U + 0
Скорость: 30 см / с

8

Применение инструкции (домашнее утюг)

• Установите шкалу утюга между хлопком и льном
• Накройте дизайн крафт-бумагой или антипригарным покрытием
• Поместите на плоскую твердую поверхность (гладильная доска не рекомендуется)
• Утюг со средним/ сильное давление (не скользить утюгом)
• Прижимайте каждую часть дизайна в течение 10-15 секунд
• Если области дизайна приподнимаются после нанесения, замените защитный лист
и повторно прижмите в течение 5-10 секунд
• Снимите носитель в горячем или холодном состоянии Инструкции по нанесению (термопресс)

• Обрежьте в обратном направлении
• Удалите излишки материала
• Предварительно прогрейте изделие в течение 2-3 секунд
• Нанесите рисунок при 320°F/160°C
• Используйте среднее/твердое давление для 20 секунд
• Держатель для снятия в горячем или холодном состоянии 9035 9 8
Easyweed Retter применяется к: 100% хлопок
Poly / хлопчатобумажные смеси
100% полиэстер
кожа
Lycra® / Spandex



Отмывание: ждать 24 часа до 1-й стирки
Машинная стирка в холодной воде/мягким моющим средством
Сушить в обычном режиме сушки
Не подвергать химчистке

Ремни топливного бака Spectra Premium ST88 Spectra Premium

( 1 )

Номер детали: SGT-ST88

Марка:

Номер детали производителя:

СТ88

Тип детали:

Линейка продуктов:

Номер по каталогу Summit Racing:

SGT-ST88

СКП:

671607131017

Длина ремня топливного бака 1 (дюйм.):

34,875 дюйма

Ремень топливного бака, длина 2 (дюйма):

34,875 дюйма

Монтажное оборудование в комплекте:

Количество:

Продается парой.

Ремни топливного бака Spectra Premium

Подожди! Видели ли ваши ремни топливного бака лучшие времена? Ремни для топливных баков Spectra Premium — идеальное решение ваших проблем.Замените ржавчину и повреждения высококачественной сталью. Эти монтажные ремни топливного бака изготовлены с использованием современных технологий производства с жесткими допусками. Кроме того, вы обнаружите, что их подгонка и функциональность будут превосходно работать на ваших автомобилях. Spectra Premium разрабатывает свои ремни для топливных баков таким образом, что они крепятся болтами к стандартному положению вашего автомобиля, экономя ваше время и нервы. Пришло время разорвать эти ржавые и поврежденные ремни! Поднимите ремни для топливного бака Spectra Premium и не прощайтесь со своим топливным баком.

Гарантия
Задать вопрос

Какой тип вопроса вы хотите задать?

×

Некоторые детали не разрешены к использованию в Калифорнии или других штатах с аналогичными законами/правилами.

Звоните для заказа

Это заказная деталь.Вы можете заказать эту деталь, связавшись с нами.

× ×

Варианты для международных клиентов

Варианты доставки

Если вы являетесь международным покупателем и отправляете товар на адрес в США, выберите «Доставка в США», и мы соответствующим образом оценим даты доставки.

×

Геномный анализ внебольничного метициллин-резистентного золотистого стафилококка ST88 в Гане [PeerJ]

Sa_NOG-W02 Регион Большой Аккры cld, tet, amp, ery, fox, ctx, chl, cro т939, агр-3, ПВЛ+ Это исследование
Sa_NOG-W25 Регион Большой Аккры gen, amk, cld, str, amp, tet, sxt, cfx, ctx, chl, cro т448, агр-3, ПВЛ- Это исследование
Sa_NOG-W11 Регион Большой Аккры str, amk, gen, sxt, cfx, cld, fox, ctx, tet, chl, cro, amp, ery т186, агр-3, ПВЛ+ Это исследование
Sa_NOG-W13 Регион Большой Аккры gen, str, amk, ctx, tet, chl, cro, sxt, cfx, amp, cld, fox 07-12-12-118-13-13, с/х-3, ПВЛ+ Это исследование
Sa_NOG-W01 Регион Большой Аккры амк, cfx, тет, ctx, chl, cro, fox т186, агр-3, ПВЛ+ Это исследование
Sa_NOG-W10 Регион Большой Аккры sxt, ery, gen, str, amk, cld, amp, cfx, tet, fox, ctx, chl, cro т186, агр-3, ПВЛ- Это исследование
Sa_NOG-W07 Регион Большой Аккры gen, str, amp, tet, sxt, cfx, chl, cro, ctx, fox, cld, ery, т448, агр-3, ПВЛ- Это исследование
Sa_NOG-W14 Регион Большой Аккры gen, ery, sxt, amk, cld, str, tet, amp, cfx, ctx, chl, cro, fox, т2649, агр-3, ПВЛ+ Это исследование
Sa_NOG-W04 Регион Большой Аккры sxt, ery, gen, str, amk, amp, cfx, tet, fox, ctx, chl, cro 07-12-21-17-13-13-34-34-33-34-34, с/х-3, ПВЛ- Это исследование
Sa_NOG-W06 Регион Большой Аккры sxt, gen, amk, cld, amp, tet, cfx, fox, chl, cro т786, агр-3, ПВЛ- Это исследование
Sa_NOG-W24 Регион Большой Аккры gen, sxt, amk, str, amp, tet, cfx, ctx, chl, cro, fox, т786, агр-3, ПВЛ+ Это исследование
Sa_NOG-W05 Регион Большой Аккры ery, amk, str, amp, cfx, tet, sxt, cld, т186, агр-3, ПВЛ- Это исследование
БУ_Г0701_т5 Восточный регион лиса, бен, окса, тет, хл т786, агр-3, ПВЛ- Амисса и др.(2015)
БУ_Г0201_т8 Восточный регион лиса, бен, окса, тет, хл т786, агр-3, ПВЛ- Амисса и др. (2015)
БУ_Г0202_т2 Восточный регион лиса, бен, окса, тет, хл т786, агр-3, ПВЛ- Амисса и др. (2015)
БУ_Г1905_т3 Восточный регион лиса, бен, окса, тет, хл т786, агр-3, ПВЛ- Амисса и др.(2015)
BU_W13_11 Восточный регион лиса, бен, окса, тет, хл т186, агр-3, ПВЛ- Амисса и др. (2015)

Границы | Высокое генетическое сходство MRSA ST88, выделенного от свиней и людей в штате Коги, Нигерия

Введение

Метициллин-резистентный штамм Staphylococcus aureus (MRSA) вызывает серьезную озабоченность как у людей, так и у ветеринаров (Vanderhaeghen et al., 2010).Такие опасения связаны с трудностями в лечении инфекций, длительной госпитализацией и увеличением расходов на здравоохранение. Свиньи могут быть бессимптомными носителями S. aureus , включая штаммы, устойчивые к метициллину, хотя инфекции S. aureus встречаются нечасто (van der Wolf et al., 2012). Основной проблемой, связанной с MRSA у свиней, является риск распространения среди людей (Unnerstad et al., 2017).

Тип последовательности MRSA (ST) 398 является преобладающим клоном, наблюдаемым у свиней из Европы и Северной Америки, тогда как MRSA ST9 преобладает в Азии.В Африке есть только четыре сообщения о MRSA у свиней; два в Южной Африке (Adegoke and Okoh, 2014; Van Lochem et al., 2018), один в Сенегале (Fall et al., 2012) и один в Нигерии (Okunlola and Ayandele, 2015). К сожалению, только в двух из четырех исследований использовались молекулярные методы для подтверждения идентификации вида S. aureus и присутствия mecA в штаммах, устойчивых к оксациллину или цефокситину, и только в одном исследовании дополнительно типировали штаммы MRSA. Фолл и др. (2012) сообщили, что их свиной MRSA принадлежал в основном к штамму ST5 и одиночному штамму ST88, которые являются основными линиями MRSA, ответственными за инфекции человека в Сенегале (Brurec et al., 2011). Было показано, что свиньи являются носителями клонов MRSA, ассоциированных с человеком, например, USA300 (Arriola et al., 2011; Baez et al., 2017). Было показано, что люди, находящиеся в тесном контакте со свиньями (фермеры, ветеринары, перевозчики и работники скотобоен), подвергаются большему риску заражения MRSA, ассоциированным с домашним скотом (LA-MRSA) (Denis et al., 2009; Liu et al. , 2015). Однако сообщалось о LA-MRSA у людей, не контактировавших со свиньями или свинофермами (Larsen et al., 2017). В Нигерии нет опубликованных данных о колонизации свиней MRSA и возможной передаче штаммов между свиньями и людьми.Нашей целью было оценить встречаемость MRSA у свиней и сравнить штаммы со штаммами, выделенными от людей, контактировавших со свиньями и не контактировавших с ними.

Материалы и методы

Заявление об этике

Исследование и протокол были одобрены институциональным наблюдательным советом клинической больницы государственного университета Коги. От каждого участника было получено информированное устное согласие, а владельцы свиноферм дали согласие на взятие проб у своих животных.

Коллекция образцов

Исследование проводилось в период с сентября 2013 г. по февраль 2015 г. и охватило 16 из 21 района местного самоуправления в штате Коги (рис. 1).Образцы были собраны на 35 свинофермах, где содержалось от 28 до 275 свиней на ферме. От 10 до 15 свиней случайным образом отбирали на ферме. Когда свиней содержали в загонах (т. е. на фермах 5/35), отбирали по две свиньи на загон. На тех фермах, где свиней не содержали в загонах, свиней отбирали случайным образом. Человеческие образцы были взяты у 55 работников свиноводческих ферм (свиньи контактируют с людьми). Численность сельскохозяйственных рабочих на одно хозяйство колебалась от 1 до 6 человек (мода = 1). Также были отобраны двести студентов Государственного университета Коги в Аньигбе, которые не контактировали со свиньями (люди, не контактировавшие со свиньями).Всем участникам-людям был предоставлен стандартизированный вопросник для сбора демографических данных, истории болезни за предыдущие 12 месяцев, например, госпитализация и антимикробная терапия, а также информация о контактах со свиньями.

Рисунок 1 . Географическое расположение свиноферм в 21 районе местного самоуправления и Государственном университете Коги (обозначено желтым квадратом). Черные точки обозначают свиноводческие фермы, отрицательные по MRSA. Красные точки обозначают свинофермы с положительным результатом на MRSA, где были обнаружены только свиньи.Синие точки обозначают свинофермы, на которых были обнаружены только люди, а не свиньи. Зеленые точки обозначают свинофермы, содержащие как свиней, так и людей с положительным результатом на MRSA.

Выделение и характеристика MRSA

Мазки из носа собирали стерильным ватным тампоном, вставленным в обе передние ноздри каждой свиньи и человека, и помещали в 3 мл бульона Мюллера-Хинтона (Oxoid, Великобритания) с добавлением 6,5% хлорида натрия и инкубировали при 37°C в течение 24 часов. . Петлю инокулята из бульона для обогащения наносили штрихом на агар Brilliance (Oxoid, Великобритания).После инкубации при 37°C в течение 24 часов колонии с подозрением на MRSA (колонии цвета джинсовой ткани) пересевают на 5% агар с овечьей кровью и инкубируют при 37°C в течение 24 часов. Изоляты определяли с помощью времяпролетной масс-спектрофотометрии с лазерной десорбцией/ионизацией с матрицей (MALDI-TOF MS) (BioMérieux, Франция). Подтвержденные изолята S. aureus хранились при температуре -20°C для дальнейшего анализа. Тестирование чувствительности к противомикробным препаратам проводили с использованием системы Sensititre и планшета COMPAN1F MIC (ThermoFisher Scientific, США), чувствительность интерпретировали в соответствии с CLSI (Clinical and Laboratory Standards Institute (CLSI), 2014).MRSA были охарактеризованы с помощью мультиплексной ПЦР для обнаружения spa, mec A, lukF-PV (маркер лейкоцидина Пантона-Валентайна, PVL) , scn и специфической полосы CC398 (Islam et al., 2017). . Прямое секвенирование очищенной реакции ПЦР использовали для типирования spa (Harmsen et al., 2003). Четыре изолята (одна свинья, один человек, контактировавший со свиньей, из той же свинофермы, один человек, не контактировавший со свиньей, из того же района и один человек, контактировавший со свиньей, из другого района) были отобраны для дальнейшего использования SCC mec (Kondo и другие., 2007), мультилокусное секвенирование (Enright et al., 2000) и полногеномное секвенирование (WGS).

Полногеномное секвенирование

Ночные культуры выращивали в трипсиновом соевом бульоне при 37°C при встряхивании со скоростью 200 об/мин. Геномную ДНК выделяли из культур с помощью автоматического прибора Maxwell DNA с использованием набора Maxwell ® RSC Cultured Cells DNA Kit (Promega, Великобритания). Подготовку библиотеки проводили с использованием набора Nextera XT и парного секвенирования концов 2 × 250 п.н. на MiSeq, все в соответствии со стандартными протоколами Illumina (Illumina, Inc., Соединенные Штаты). Все необработанные чтения были депонированы в базе данных Sequence Read Archive в Европейском архиве нуклеотидов под регистрационным номером исследования PRJEB26533.

Филогенетика и сравнительная геномика

Все анализы были выполнены в CLC Genomics Workbench v. 11.0 с использованием инструментов модуля Microbial Genomics. Во-первых, анализ Kmer был выполнен по базе данных NCBI RefSeq и включал только полные геномы стафилококков. Этот анализ был выполнен, чтобы определить, было ли какое-либо загрязнение ДНК перед секвенированием, и в качестве вторичного подтверждения наличия S.aureus видовая идентификация. Во-вторых, высококачественные прочтения, обрезанные адаптером, были сопоставлены с эталонным геномом AUS0325, закрытым метициллин-чувствительным, пенициллин-резистентным геномом ST88 (инвентарный номер NCBI LT615218) для идентификации однонуклеотидных полиморфизмов (SNP). Дерево максимального правдоподобия было создано из SNP основного генома. Для дальнейшего изучения клонального родства MRSA ST88 с африканского континента наши штаммы сравнивали с 17 общедоступными штаммами MRSA ST88, выделенными в Гане (Kpeli et al., 2017). Веб-конвейеры Resfinder v.3.0 и Virulence finder v.1.5 использовались для поиска известных генов вирулентности и устойчивости к антибиотикам (Zankari et al., 2012; Joensen et al., 2014).

Результат

MRSA был обнаружен у 20/425 (4,7%) свиней, 6/55 (10,9%) работников свиноводческих ферм и 12/200 (6,0%) людей, не контактировавших со свиньями (таблица 1). Положительные на MRSA свиньи были получены с 12 ферм (рис. 1). Несмотря на выборку нескольких свиней на ферме, только 4 из 12 ферм имели более 1 положительной свиньи на MRSA.Шесть изолятов MRSA человека были выделены от людей, контактировавших со свиньями, на шести свинофермах. Однако только 3/6 особей прибыли с ферм, где также содержались свиньи, положительные на MRSA. Более того, несмотря на то, что на этих шести фермах было отобрано более одного работника свинофермы, только один человек на ферме дал положительный результат. Остальные 12 MRSA были выделены у студентов университета, не контактировавших со свиньями. Ни один из лиц с положительным результатом на MRSA не сообщил о приеме антибиотиков, и только один работник свинофермы сообщил о госпитализации за последние 12 месяцев до взятия проб.

Таблица 1 . Характеристика MRSA, выделенного от свиней, рабочих свиноферм и людей, не контактировавших со свиньями.

Все 38 изолятов MRSA были устойчивы только к пенициллину и цефокситину, и имелось соответствие между фенотипической и предполагаемой генотипической резистентностью. Все штаммы были положительными в отношении специфической полосы CC398. Однако секвенирование spa показало, что все штаммы имели один и тот же тип spa , t1603, который не связан с типами spa , обычно связанными с CC398.Кроме того, MLST показал, что штаммы принадлежат ST88. в SILICO ПЦР с использованием специфических праймеров CC398, которые нацеливаются на вариант C398, специфичной SAU1-HSDS1 , ( FP2SAU1 : 5’gagaatgatttttgtttataaccctag3 ‘и CC398R1: 5′-Cagtataaagaggtgacatgacccccccct-3’) и наши de novo собранных контигов, показали, что праймеры связываются на 100% и продуцируют ожидаемый ампликон размером 106 п.н. Праймеры связываются с открытой рамкой считывания (ORF) с 99% идентичностью нуклеотидов с hsdS , который представляет собой ген специфичности последовательности системы рестрикции-модификации Sau1 типа I (данные не показаны). mecA размещался на кассете SCC mec типа VIa.

По данным WGS, основной геном состоял из 2407 кодирующих последовательностей ДНК (CDS), из которых S. aureus AUS0325 использовались в качестве эталона. Филогенез основного генома был выведен путем сопоставления прочтений четырех секвенированных изолятов с AUS0325, и было построено филогенетическое дерево с использованием SNP основного генома и оценки максимального правдоподобия. По отношению к AUS0325 было идентифицировано 1248 SNP, но только 11 SNP были обнаружены между четырьмя изолятами в этом исследовании, несмотря на временные и географические различия (таблица 2; рисунок 2).Изоляты из одного и того же региона, т. е. из Ангибы, несмотря на 2-летний перерыв, отличались только 3–8 SNP. Филогенетическое сравнение с 17 штаммами ST88 из Ганы указывает на то, что нигерийские изоляты образовали отдельную кладу с различиями в 700 SNP (рис. 3).

Таблица 2 . Однонуклеотидные полиморфизмы в AM492, AM496, AM497 и AM526 относительно эталонного генома ST88, AUS0325.

Рисунок 2 . Филогенез основного генома с использованием AUS0325 в качестве эталонного генома.MRSA ST88 от свиньи, свиньи, контактировавшей с человеком, и не свиньи, контактировавшей с человеком. Филогения основана на выравнивании 1248 SNP. Предоставляются метаданные, описывающие происхождение проб, место их взятия в штате Коги и дату выделения. Цифры указывают различия SNP.

Рисунок 3 . Сравнительный анализ нигерийского и ганского MRSA ST88. Филогенез основного генома на основе выравнивания 1492 SNP. Число на рисунке указывает на различия SNP.

Все штаммы MRSA были pvl отрицательными, а 37 из 38 штаммов содержали человеческий ген уклонения от иммунитета scn .Единственный штамм, который был scn- отрицательным, был свиного происхождения. Кроме того, основываясь на анализе de novo контигов в Virulence Finder, все четыре штамма содержали следующие предположительно ассоциированные с вирулентностью гены scn, sak, lukE, lukD , gamma hemolysin, aur, splA и splB .

Обсуждение

Мы впервые описываем выделение генетически подтвержденного MRSA у свиней и рабочих свиноводческих ферм в Нигерии. Это всего лишь пятое описание MRSA у здоровых свиней на африканском континенте, и, похоже, это не типичные клоны, связанные с домашним скотом, обнаруженные у свиней во всем мире, а именно CC398 и CC9.

Все изоляты MRSA, обнаруженные в этом исследовании, принадлежали к ST88, который был выделен из внутрибольничных и внебольничных инфекций у людей в нескольких странах Африки к югу от Сахары, включая Нигерию (Ghebremedhin et al., 2009; Shittu et al., 2012; Kolawole et al., 2013; Raji et al., 2013; Abdulgader et al., 2015). ST88, по-видимому, в первую очередь связан с африканским континентом, но также был зарегистрирован в Азии и спорадически в других частях мира (Schaumburg et al., 2014). Ассоциация ST88 и домашнего скота была описана только в Африке. В частности, MRSA ST88 был обнаружен в одном изоляте свиней из Сенегала и здоровых овцах в Кот-д’Ивуаре (Fall et al., 2012; Schaumburg et al., 2015). В Китае MRSA ST88 был обнаружен в пищевых продуктах животного происхождения и недавно у работников животноводства (Wang et al., 2014; Ye et al., 2016).

MRSA у свиней и свиноводов в Африке впервые был зарегистрирован в Сенегале (Fall et al., 2012), однако MRSA не был выделен у сельскохозяйственных рабочих.В Нигерии было зарегистрировано только одно сообщение о фенотипически устойчивом к оксациллину штамме S. aureus у свиней из штата Ойо на юго-западе Нигерии (Okunlola and Ayandele, 2015). Только 18/200 (9%) свиней были положительными на предполагаемый MRSA на 7 из 11 отобранных ферм. MRSA был выделен от других животных в Нигерии, а именно; верблюдов, овец, крупного рогатого скота, коз, а недавно и домашней птицы (Mai-siyama et al., 2014; Nworie et al., 2017). Как и в случае с (Окунлола и Аянделе, 2015 г.), мы наблюдали несколько положительных на MRSA животных на каждой ферме.Более того, все наши изоляты MRSA в этом исследовании принадлежат к одному и тому же типу spa (t1603) независимо от источника (свинья, человек, контактировавший со свиньей или человек, не контактирующий со свиньей), и на основании WGS высокое генетическое сходство вызывает вопросы. о происхождении этих штаммов. Кластер уклонения от иммунного ответа (IEC), который находится на бактериофаге и кодирует секретируемые белки, ингибитор стафилококкового комплемента ( scn ), стафилокиназу ( sak ) и белок, ингибирующий хемотаксис ( chp ), способствует уклонение от иммунитета у людей (van Wamel et al., 2006). Более того, эти гены менее распространены в адаптированных для домашнего скота линиях S. aureus и, следовательно, считаются хорошими генетическими маркерами для идентификации клонов S. aureus , ассоциированных с человеком (McCarthy et al., 2011, 2012; Uhlemann et al., 2012). ). Мы обнаружили высокую заболеваемость scn среди наших свиных изолятов (19/20 изолятов) и дополнительную встречаемость sak на основе данных WGS. Наличие этих генов, связанных с IEC, предполагает возможное человеческое происхождение и то, что свиньи были либо временно заражены сельскохозяйственными рабочими, либо в результате совсем недавнего случая передачи инфекции от человека к свинье.Ассоциированные с человеком линии S. aureus ранее были описаны у животных, включая свиней (Arriola et al., 2011; Schaumburg et al., 2012; Nagel et al., 2013; Baez et al., 2017).

В нашем исследовании MRSA ST88 был устойчив только к бета-лактамам. Как правило, устойчивость к антибиотикам среди изолятов животных S. aureus , как правило, выше, чем у изолятов человека. Исследование устойчивых к метициллину коагулазонегативных стафилококков (MRCoNS) свиного происхождения в Нигерии показало, что изоляты обладают множественной лекарственной устойчивостью (MDR), 85% штаммов устойчивы к фузидовой кислоте и содержат ряд различных генов устойчивости к антибиотикам. Угву и др., 2015). CoNS являются резервуаром генов устойчивости к антибиотикам с возможностью переноса в S. aureus , как это было продемонстрировано плазмидным переносом mupA , придающим устойчивость к мупироцину, от S. haemolyticus к S. aureus. (Росси и др., 2016). Вполне возможно, что эти штаммы MRSA ST88 с низким уровнем устойчивости, если им будет позволено адаптироваться к свиньям и занять ту же нишу, что и MDR MRCoNS, обеспечат возможность переноса генов устойчивости к антибиотикам для потенциального создания MDR CA-MRSA.

Все наши штаммы были предположительно идентифицированы как принадлежащие к CC398. Однако при дополнительном типировании штаммов оказалось, что это неверно. Типирование MRSA имеет ключевое значение для эпиднадзора, эпидемиологических исследований и инфекционного контроля. Быстрые и надежные методы идентификации, такие как методы на основе ПЦР, являются важными инструментами для идентификации MRSA и его типа до уровня клонального комплекса. ПЦР, специфичная для CC398, является отличным инструментом для быстрой идентификации S. aureus , принадлежащих к CC398, который, как было показано, на 100% специфичен только для CC398 (Stegger et al., 2011). Эта ПЦР основана на sau1-hsdS , поскольку ранее было показано, что вариации этого гена связаны со специфическими клональными линиями S. aureus , но сохраняют высокую гомологию последовательностей внутри этой линии (Waldron and Lindsay, 2006). Этот подход также использовался для быстрой идентификации линий внутрибольничного MRSA (Cockfield et al., 2007). К сожалению, во время исследования Stegger et al. (2011) не было общедоступных геномов ST88, и штаммы, принадлежащие к ST88, не были включены в исследование, поскольку ST88 не является типичным LA-MRSA и не является широко распространенным клоном, ассоциированным с человеком.В свете наших выводов мы рекомендуем, чтобы с текущими праймерами ПЦР результат ПЦР, специфичный для CC398, был дополнен типированием spa или другим методом для проверки ассоциации клональной линии.

Наше исследование имеет некоторые ограничения. В идеале все 38 штаммов MRSA должны быть полностью секвенированы, чтобы лучше понять разнообразие штаммов ST88 в этом регионе и изучить возможные случаи передачи. Однако последнее было бы трудно оценить, поскольку у нас нет информации о перемещении свиней e.г., через торговлю, контакты и перемещение людей. Кроме того, мы не могли секвенировать все штаммы из-за финансовых ограничений.

Животноводство является известным резервуаром новых патогенных бактерий, обладающих способностью преодолевать барьер вида-хозяина и развиваться специфичным для хозяина образом, чтобы прижиться в человеческой популяции. Это было продемонстрировано для LA-MRSA CC398 (Price et al., 2013). В Нигерии необходимы дальнейшие исследования, чтобы определить, было ли носительство MRSA среди свиней временным или постоянным, установить точные пути передачи на свинофермах и изучить меры биобезопасности для предотвращения распространения MRSA в среде фермы.Хотя у нашего исследования есть ограничения; дизайн перекрестного исследования, проводимого только в один момент времени, тем не менее, мы предоставляем ценную информацию на континенте, где имеется ограниченное количество исследований, описывающих возникновение MRSA у животных, и еще меньше исследований, предоставляющих данные молекулярного типирования.

Вклад авторов

OO, JK и EO, разработанные для работы. OO, JK, EO, MI и AM выполнили сбор, анализ и интерпретацию данных. OO, JK, EO, MI и AM подготовили и отредактировали рукопись.Все авторы одобрили окончательную версию этой рукописи.

Финансирование

Отбор проб, выделение и предварительный анализ MRSA были профинансированы OO в рамках этого докторского проекта. О.О. получил грант от Государственного университета Коги на краткосрочную исследовательскую стажировку для выполнения молекулярной характеристики MRSA в Копенгагенском университете, Дания. Молекулярная характеристика финансировалась Датским советом по независимым исследованиям, технологиям и производственным наукам (DFF-FTP).

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Благодарности

Мы хотели бы поблагодарить Татьяну П. Кристенсен и Манью Ханегард за техническую помощь.

Ссылки

Абдулгадер, С. М., Шитту, А. О., Никол, М. П., и Каба, М. (2015). Молекулярная эпидемиология метициллин-резистентного Staphylococcus aureus в Африке: систематический обзор. Перед. Микробиол . 30:348. doi: 10.3389/fmicb.2015.00348

Полнотекстовая перекрестная ссылка | Академия Google

Адегоке, А.А., и Окох, И.А. (2014). Видовое разнообразие и свойства устойчивости к антибиотикам Staphylococcus сельскохозяйственного происхождения в муниципалитете Нконкобе, Южная Африка. Фолиа. Микробиол . 59, 133–140. doi: 10.1007/s12223-013-0275-1

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Арриола, К.С., Гере, М.Э., Ларсен Дж., Сков Р.Л., Гилман Р.Х., Гонсалес А.Е. и соавт. (2011). Наличие метициллин-резистентного Staphylococcus aureus у свиней в Перу. ПЛОС ОДИН . 6:e28529. doi: 10.1371/journal.pone.0028529

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Баез, М., Колло, А., Эспиноса, И., и Перретен, В. (2017). MRSA USA300, USA300-LV и ST5-IV у свиней, Куба. Междунар. Дж. Антимикроб. Агенты . 49, 259–261. doi: 10.1016/j.ijantimicag.2016.12.001

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Бреурек, С., Зриуил, С. Б., Фолл, К., Буазье, П., Брис, С., Джибо, С., и другие. (2011). Эпидемиология устойчивых к метициллину штаммов Staphylococcus aureus в пяти крупных африканских городах: появление и распространение атипичных клонов. клин. микробиол. Заразить . 17, 160–165. doi: 10.1111/j.1469-0691.2010.03219.x

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Институт клинических и лабораторных стандартов (CLSI) (2014 г.). Стандарты эффективности для тестирования чувствительности к противомикробным препаратам; Двадцать четвертое информационное дополнение , Vol. 34. Документ CLSI M100-24S. Уэйн: Институт клинических и лабораторных стандартов.

Кокфилд, Дж. Д., Патхак, С., Эджворт, Дж. Д., и Линдси, Дж. А. (2007). Быстрое определение внутрибольничных штаммов Staphylococcus aureus , устойчивых к метициллину. J. Med. Микробиол . 56, 614–619. doi: 10.1099/jmm.0.47074-0

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Денис О., Suetens, C., Hallin, M., Catry, B., Ramboer, I., Dispas, M., et al. (2009). Метициллин-резистентный штамм Staphylococcus aureus ST398 у персонала свинофермы, Бельгия. Экстренный. Заразить Диса . 15, 1098–1101. дои: 10.3201/eid1507.080652

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Enright, M.C., Day, N.P., Davies, C.E., Peacock, SJ, and Spratt, B.G. (2000). Мультилокусное типирование последовательности для характеристики метициллин-устойчивых и метициллин-чувствительных клонов Staphylococcus aureus . Дж. Клин. Микробиол . 38, 1008–1015.

Реферат PubMed | Академия Google

Fall, C., Seck, A., Richard, V., Ndour, M., Sembene, M., Laurent, F., et al. (2012). Эпидемиология Staphylococcus aureus у свиней и фермеров на крупнейшей ферме в Дакаре, Сенегал. Патог пищевого происхождения. Дис . 9, 962–965. doi: 10.1089/fpd.2012.1197

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Гебремедин Б., Олугбоси М. О.и Раджи, А.М. (2009). Появление штамма Staphylococcus aureus , устойчивого к метициллину, связанного с сообществом, с уникальным профилем устойчивости на юго-западе Нигерии. Дж. Клин. Микробиол . 47, 2975–2980. doi: 10.1128/JCM.00648-09

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Хармсен, Д., Клаус, Х., Витте, В., Ротгенгер, Дж., Клаус, Х., Тернвальд, Д., и др. (2003). Типирование метициллин-резистентного Staphylococcus aureus в условиях университетской больницы с использованием нового программного обеспечения для повторного определения spa и управления базой данных. Дж. Клин. микробиол. 41, 5442–5448. doi: 10.1128/JCM.41.12.5442-5448.2003

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ислам, М.З., Эспиноза-Гонгора, К., Дамборг, П., Зибер, Р.Н., Мунк, Р., Хастед, Л., и др. (2017). Лошади в Дании являются резервуаром разнообразных клонов метициллин-резистентного и восприимчивого к метициллину золотистого стафилококка. Перед. Микробиол . 8:543. doi: 10.3389/fmicb.2017.00543

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Йонсен, К.Г., Шойц Ф., Лунд О., Хасман Х., Каас Р.С., Нильсен Э.М. и соавт. (2014). Полногеномное секвенирование в режиме реального времени для рутинного типирования, эпиднадзора и выявления вспышек веротоксигенной Escherichia coli . Дж. Клин. Микобиол . 52, 1501–1510. doi: 10.1128/JCM.03617-13

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Колаволе, О.Д., Адеянью, А., Шаумбург, Ф., Акиньюола, Л.А., Лаваль, О.О., Амуса, Ю.Б., и соавт. (2013). Характеристика колонизации Staphylococcus aureus , выделенного от пациентов хирургических отделений нигерийской университетской больницы. ПЛОС ОДИН . 8:e68721. doi: 10.1371/journal.pone.0068721

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Кондо, Ю., Ито, Т., Ма, X. X., Ватанабэ, С., Крейсвирт, Б. Н., Этьен, Дж., и др. (2007). Комбинация мультиплексных ПЦР для присвоения типа стафилококковой кассеты mec : система быстрой идентификации для mec, ccr и основные различия в регионах свалки. Антимикробные агенты Chemother . 51, 264–274.doi: 10.1128/AAC.00165-06

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Кпели Г., Бултьенс А. Х., Джулиери С., Овусу-Миреку Э., Абоагье С. Ю. и Бейнс С. Л. (2017). Геномный анализ ST88 внебольничного метициллин-резистентного Staphylococcus aureus в Гане. PeerJ . 28:e3047. doi: 10.7717/peerj.3047

Полнотекстовая перекрестная ссылка | Академия Google

Ларсен Дж., Петерсен А., Ларсен А. Р., Зибер Р. Н., Стеггер М., Кох А. и соавт. (2017). Возникновение метициллин-резистентных метициллин-резистентных штаммов Staphylococcus aureus , связанных с домашним скотом, в Дании. клин. Заразить. Дис . 67, 1072–1076. doi: 10.1093/cid/cix504

Полнотекстовая перекрестная ссылка | Академия Google

Лю, В., Лю, З., Яо, З., Фан, Ю., Йе, X., и Чен, С. (2015). Распространенность и влияющие факторы носительства метициллинрезистентного Staphylococcus aureus у людей, контактирующих с домашним скотом: систематический обзор. утра. Дж. Заразить. Продолжение . 43:469–475. doi: 10.1016/j.ajic.2014.12.009

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Mai-siyama, I.B., Okon, K.O., Adamu, N.B., Askira, U.M., Isyaka, T.M., Adamu, S.G., et al. (2014). Уровень колонизации метициллин-резистентным штаммом Staphylococcus aureus (MRSA) среди жвачных животных, забитых для потребления человеком, и контактных лиц в Майдугури, Нигерия. фр. Дж. Микробиол. Рез . 8, 2643–2649.дои: 10.5897/AJMR2014.6855

Полнотекстовая перекрестная ссылка | Академия Google

Маккарти, А. Дж., ван Вамель, В., Вандендрисше, С., Ларсен, Дж., Денис, О., Гарсия-Граэллс, К., и соавт. (2012). Staphylococcus aureus Клада CC398, связанная с передачей от человека к человеку. Заяв. Окружающая среда. микробиол. 78, 8845–8848. doi: 10.1128/AEM.02398-12

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Маккарти, А.Дж., Уитни, А.А., Гулд, К.А., Мудли А., Гуардабасси Л., Восс А. и соавт. (2011). Распространение мобильных генетических элементов (МГЭ) в MRSA CC398 связано как с хозяином, так и со страной. Геном. биол. Эвол . 3, 1164–1174. doi: 10.1093/gbe/evr092

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Нагель, М., Дишингер, Дж., Тюрк, М., Верриер, Д., Оденковен, М., Нгоубангойе, Б., и другие. (2013). Ассоциированные с человеком штаммы Staphylococcus aureus в популяциях человекообразных обезьян в Центральной Африке (Габон). клин. микробиол. Заразить. 19, 1072–1077. дои: 10.1111/1469-0691.12119

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Нворие, А., Оньема, А.С., Окекпа, С.И., Элом, М.О., Умох, Н.О., Усанга, В.У., и соавт. (2017). Новый устойчивый к метициллину штамм Staphylococcus aureus t11469 и эндемичный штамм домашней птицы t002 (ST5) обнаружены у кур в штате Эбони, Нигерия. Биомед. Рез. Междунар. 2936461. doi: 10.1155/2017/2936461

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Окунлола И.О. и Аянделе А.А. (2015). Распространенность и чувствительность к противомикробным препаратам метициллин-резистентного Staphylococcus aureus (MRSA) среди свиней на отдельных фермах в Илоре, Юго-Западная Нигерия. евро. Дж. Эксп. Био . 5, 50–56.

Академия Google

Прайс Л.Б., Стеггер М., Хасман Х., Азиз М., Ларсен Дж., Андерсен П.С. и др. (2013). Staphylococcus aureus CC398: адаптация хозяина и появление резистентности к метициллину у домашнего скота. МБио .3:e00305–e00311. doi: 10.1128/mBio.00305-11

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Раджи, А., Оджемхен, О., Умеджибуру, У., Огунлейе, А., Блан, Д.С., и Бассет, П. (2013). Высокое генетическое разнообразие Staphylococcus aureus в больнице третичного уровня на юго-западе Нигерии. Диагн. микробиол. Заразить. Дис . 77, 367–369. doi: 10.1016/j.diagmicrobio.2013.08.030

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Росси, К.К., Феррейра, Н.К., Коэльо, М.Л., Шуенк, Р.П., Бастос Мдо, К., и Джамбиаджи-деМарваль, М. (2016). Перенос устойчивости к мупироцину от Staphylococcus haemolyticus клинических штаммов к Staphylococcus aureus посредством конъюгативных и мобилизуемых плазмид. FEMS Microbiol Lett . 363:fnw121. doi: 10.1093/femsle/fnw121

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Шаумбург Ф., Алаби А. С., Петерс Г. и Беккер К.(2014). Новая эпидемиология инфекции Staphylococcus aureus в Африке. клин. микробиол. Заразить . 20, 589–596. дои: 10.1111/1469-0691.12690

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Шаумбург Ф., Мугиша Л., Пек Б., Беккер К., Гиллеспи Т.Р., Петерс Г. и др. (2012). Лекарственно-устойчивый человеческий штамм Staphylococcus aureus у обезьян из заповедника представляет угрозу для находящихся под угрозой исчезновения популяций диких обезьян. утра. Дж. Приматол .74, 1071–1075. doi: 10.1002/ajp.22067

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Шаумбург, Ф., Поли, М., Ано, Э., Моссун, А., Вирсма, Л., Шуберт, Г., и другие. (2015). Комплекс Staphylococcus aureus от животных и человека в трех отдаленных африканских регионах. клин. микробиол. Заразить . 21, 345.e1-8. doi: 10.1016/j.cmi.2014.12.001

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Шитту, А., Ойэдара, О., Абегунрин Ф., Окон К., Раджи А., Тайво С. и соавт. (2012). Характеристика метициллин-чувствительных и устойчивых стафилококков в клинических условиях: многоцентровое исследование в Нигерии. BMC Infect Dis . 12:286. дои: 10.1186/1471-2334-12-286

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Стеггер, М., Линдси, Дж. А., Мудли, А., Сков, Р., Броенс, Э. М., и Гуардабаси, Л. (2011). Быстрая ПЦР-детекция клонального комплекса Staphylococcus aureus 398 путем нацеливания на систему рестрикции-модификации, несущую sau1-hsdS1. Дж. Клин. микробиол. 49, 732–734. doi: 10.1128/JCM.01970-10

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Угву, К.С., Гомес-Санс, Э., Агбо, И.С., Торрес, К., и Ча, К.Ф. (2015). Характеристика ферментирующих маннит устойчивых к метициллину стафилококков, выделенных от свиней в Нигерии. Браз. Дж. Микробиол . 46, 885–892. дои: 10.1590/S1517-838246320140644

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Улеманн, А.C., Porcella, S.F., Trivedi, S., Sullivan, S.B., Hafer, C., Kennedy, A.D., et al. (2012). Идентификация высококонтагиозного независимого от животных клона Staphylococcus aureus ST398 с отличными свойствами генома и клеточной адгезии. МБио . 3:e00027–e00012. doi: 10.1128/mBio.00027-12

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Уннерстад, Э. Х., Вальстрем, Х., Моландер, Б., и Бенгтссон, Б. (2017). Метициллин-резистентный штамм Staphylococcus aureus не обнаружен в шведских нуклеусах и размножающихся стадах свиней. Заразить. Эко Эпидемиол . 7:1313068. дои: 10.1080/20008686.2017.1313068

Полнотекстовая перекрестная ссылка | Академия Google

Ван дер Вольф, П. Дж., Роткамп, А., Юнкер, К., и де Нилинг, А. Дж. (2012). Staphylococcus aureus (MSSA) и MRSA (CC398), выделенные из патологоанатомических образцов свиней. Вет. Микробиол . 158, 136–141. doi: 10.1016/j.vetmic.2012.01.025

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ван Лохем, С., Томпсон, П. Н., и Аннандейл, Ч. Х. (2018). Распространенность метициллин-резистентного Staphylococcus aureus среди крупных коммерческих стад свиней в Южной Африке. Ондерстепорт. Дж. Вет. Рез . 85:e1–e4. дои: 10.4102/ojvr.v85i1.1561

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

ван Вамель, В.Дж., Ройяккерс, С.Х., Руйкен, М., ван Кессель, К.П., и ван Стрейп, Дж.А. (2006). Модуляторы врожденного иммунитета, стафилококковый ингибитор комплемента и белок, ингибирующий хемотаксис Staphylococcus aureus , расположены на бета-гемолизин-конвертирующих бактериофагах. J. Бактериол . 188:1310–1315. doi: 10.1128/JB.188.4.1310-1315.2006

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Vanderhaeghen, W., Hermans, K., Haesebrouck, F., and Butaye, P. (2010). Метициллин-резистентный штамм Staphylococcus aureus (MRSA) у сельскохозяйственных животных. Эпидемиол. Заразить. 138, 606–625. дои: 10.1017/S0950268809991567

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Уолдрон, Д.Э. и Линдси, Дж. А. (2006). Sau1: новая специфичная для линии система рестрикции-модификации типа I, которая блокирует горизонтальный перенос генов в Staphylococcus aureus и между изолятами S. aureus разных линий. J. Бактериол. 188, 5578–5585. doi: 10.1128/JB.00418-06

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ван, X., Ли, Г., Ся, X., Ян, Б., Си, М., и Мэн, Дж. (2014). Чувствительность к противомикробным препаратам и молекулярное типирование метициллин-резистентного золотистого стафилококка в розничных пищевых продуктах в Шэньси, Китай. Патог пищевого происхождения. Дис. 11, 281–286. doi: 10.1089/fpd.2013.1643

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ye, X., Wang, X., Fan, Y., Peng, Y., Li, L., Li, S., et al. (2016). Генотипические и фенотипические маркеры связанного с домашним скотом метициллин-резистентного Staphylococcus aureus CC9 у людей. Заяв. Окружающая среда. микробиол. 82, 3892–3899. doi: 10.1128/AEM.00091-16

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Занкари, Э., Hasman, H., Cosentino, S., Vestergaard, M., Rasmussen, S., Lund, O., et al. (2012). Выявление генов приобретенной устойчивости к противомикробным препаратам. J. Антимикроб. Чемотер . 67, 2640–2644. doi: 10.1093/jac/dks261

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Преобладание метициллинрезистентного Staphylococcus aureus -ST88 и нового ST1797, вызывающего раневую инфекцию и абсцессы

  • Ньямбура Мореми Католический университет здоровья и смежных наук, Мванза, Танзания
  • Стивен Э. Мшана Католический университет здоровья и смежных наук, Мванза, Танзания
  • Эразм Камугиша Католический университет здоровья и смежных наук, Мванза, Танзания
  • Йоханнес Катарайхья Католический университет здоровья и смежных наук, Мванза, Танзания
  • Деннис Тэпп Университет Вюрцбурга, Вюрцбург, Германия
  • Ульрих Фогель Университет Вюрцбурга, Вюрцбург, Германия
  • Элигиус Ф Лямуя Университет здоровья и смежных наук Мухимбили, Дар-эс-Салам, Танзания
  • Хайке Клаус Университет Вюрцбурга, Вюрцбург, Германия

Ключевые слова: MRSA, ST88, ST1797, Танзания

Аннотация

Введение. Несмотря на появление и распространение по всему миру метициллин-резистентного штамма Staphylococcus aureus (MRSA), мало что известно о молекулярной эпидемиологии MRSA в Танзании.

Методология. В этом исследовании мы охарактеризовали штаммы MRSA, выделенные из клинических образцов в Медицинском центре Бугандо, Танзания, в период с января по декабрь 2008 г. Из 160 изолятов S. aureus из 600 клинических образцов 24 (15%) были обнаружены MRSA. Помимо молекулярного скрининга генов лейкоцидина Пантона Валентайна (PVL) с помощью ПЦР, штаммы MRSA были дополнительно охарактеризованы с помощью многолокусного типирования последовательностей (MLST) и типирования spa .

Результаты: Несмотря на значительное генетическое разнообразие, spa типов t690 (29.1%) и t7231 (41,6%), а также сиквенс-типы (ST) 88 (54,2%) и 1797 (29,1%), доминировали среди клинических изолятов. Гены PVL обнаружены у 4 изолятов; из них 3 были обнаружены в ST 88 и один в ST1820. Устойчивость к эритромицину, клиндамицину, гентамицину, тетрациклину и котримоксазолу была обнаружена у 45,8%, 62,5%, 41,6%, 45,8% и 50% штаммов соответственно.

Заключение. Мы представляем первое тщательное типирование MRSA в танзанийской больнице. Несмотря на значительное генетическое разнообразие, ST88 доминировал среди клинических изолятов в Медицинском центре Бугандо.В будущем следует проводить активный и стандартизированный эпиднадзор за нозокомиальной инфекцией MRSA для анализа частоты инфекции и передачи и принятия эффективных мер контроля.

Как цитировать

1.

Мореми Н., Мшана С.Е., Камугиша Э., Катарайхья Дж., Таппе Д., Фогель У., Лямуя Э.Ф., Клаус Х (2012) Преобладание метициллин-резистентного золотистого стафилококка -ST88 и нового ST1797, вызывающего раневую инфекцию и абсцессы.J Infect Dev Ctries 6: 620-625. doi: 10.3855/jidc.2093

Раздел

Оригинальные статьи

Авторы, которые публикуются в этом журнале, соглашаются со следующими условиями:

  1. Авторы сохраняют за собой авторские права и предоставляют журналу право на первую публикацию, при этом работа одновременно лицензируется в соответствии с лицензией Creative Commons Attribution, которая позволяет другим распространять работу с указанием авторства работы и первоначальной публикации в этом журнале.

Станьте первым комментатором

Добавить комментарий

Ваш адрес email не будет опубликован.

2019 © Все права защищены. Интернет-Магазин Санкт-Петербург (СПБ)